Review



anti traf1  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc anti traf1
    Anti Traf1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 3183 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+traf1/p38+MAPK+XP+Rabbit+mAb/bio_rxiv__64898__2026__03__19__712937-185-26-27
    Average 97 stars, based on 3183 article reviews
    anti traf1 - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    other:

    Article Title: TRAF1 S146 is constitutively phosphorylated in primary CLL cells by PKN1/2
    Article Snippet: Anti-TRAF1 (Cell Signaling Technology (CST) clone 45D3, cat # 4715), anti-PKN2 (CST cat#2612) and anti-GAPDH (CST cat# 2118) were purchased from New England Biolabs (NEB), Whitby, ON.

    Membrane:

    Article Title: Genetically engineered IgG1 and nanobody oligomers acquire strong intrinsic CD40 agonism.
    Article Snippet: .. After transfer of proteins to a nitrocellulose membrane western blot analysis was performed with an anti-p100/p52 (#05–361, Millipore), anti-TRAF1 (#4715), anti-A20 (#5630, both Cell Signaling Technology Beverly, MA, USA), anti-β-actin (#A1978–200), anti-Flag (M2) (#F-3165, both Sigma Aldrich) and horseradish peroxidase (HRP)-conjugated polyclonal rabbit anti-mouse antibody (#P0260, Dako, Glostrup, Denmark) or HRPcoupled anti-rabbit antibody (#7074, Cell Signaling Technology Beverly, MA, USA). ..

    Western Blot:

    Article Title: Genetically engineered IgG1 and nanobody oligomers acquire strong intrinsic CD40 agonism.
    Article Snippet: .. After transfer of proteins to a nitrocellulose membrane western blot analysis was performed with an anti-p100/p52 (#05–361, Millipore), anti-TRAF1 (#4715), anti-A20 (#5630, both Cell Signaling Technology Beverly, MA, USA), anti-β-actin (#A1978–200), anti-Flag (M2) (#F-3165, both Sigma Aldrich) and horseradish peroxidase (HRP)-conjugated polyclonal rabbit anti-mouse antibody (#P0260, Dako, Glostrup, Denmark) or HRPcoupled anti-rabbit antibody (#7074, Cell Signaling Technology Beverly, MA, USA). ..

    Article Title: Selective disruption of Traf1/cIAP2 interaction attenuates inflammatory responses and rheumatoid arthritis.
    Article Snippet: Recombinant human TNF was from Invitrogen. .. For Western Blotting, the following antibodies were used: anti-c-IAP2 (Cell Signaling; 3130), anti-TRAF1 (Cell Signaling; 4715), anti-HOIL-1 (Santa Cruz; sc-393754), anti-β-actin (R&D Systems Inc.; MAB8929), anti-TRAF2 (Cell Signalling; 4724), anti-TRAF3 (Cell Signalling; 33640), anti-GAPDH (Cell Signalling; 2118), anti-TLR4 (Santa Cruz; sc-293072), anti-phospho-NF-κB p65 (Cell Signalling; 3033), anti-IκBα (Cell Signalling; 4814), anti-phospho-TAK1 (Cell Signalling; 4508), anti-phospho-c-Jun (Cell Signalling; 9261), anti-phospho-SAPK/JNK (Thr183/Tyr185) (Cell Signalling; 4668), anti-Myc-Tag (Cell Signalling; 2278), anti-FLAG-Tag (Sigma-Aldrich, F3165-1 MG), anti-phospho-IκBα (Cell Signalling; 2859). .. THP-1 cells were electroporated (Nucleofactor 4D; Lonza) with an RNP complex comprised of AltR Cas9 enzyme (Integrated DNA technologies; IDT) and a crRNA: tracer RNA duplex (sgRNA) targeting TRAF1 near V203 (crRNA: AAGCTGCGTGTGTTTGAGAACATTGTTGCTGCCCTCAACAAGGAGGTGGAGGCCTCC).



    Similar Products

    anti traf1  (Cell Signaling Technology Inc)
    97
    Cell Signaling Technology Inc anti traf1
    Anti Traf1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+traf1/p38+MAPK+XP+Rabbit+mAb/bio_rxiv__64898__2026__03__19__712937-185-26-27
    Average 97 stars, based on 1 article reviews
    anti traf1 - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    traf1  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc traf1
    Traf1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+traf1/TRAF1+Rabbit+mAb/bio_rxiv__64898__2026__03__09__710628-232-53-54
    Average 94 stars, based on 1 article reviews
    traf1 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results